Bioinformatics Essay Example

  • Category:
    Biology
  • Document type:
    Math Problem
  • Level:
    Masters
  • Page:
    1
  • Words:
    492

Bioinformatics Assignment

Bioinformatics Assignment

Part A. Sequence Identification

QA1. Chlamydomonas reinhardtii (X78589.1)

  • mRNA-the sequence corresponds to a mRNA

QA2. The tool used was the blastn. The tool allowed a comparison between various nucleotide sequences in the database and performs statistical comparisons between matches. Therefore, help identify member of a gene as was the case with question 1.

QA4. Species: Chlamydomonas reinhardtii Genus: Chlamydomonas Phylum: Chlorophyta

QA5. Bernstein,M., Beech,P.L., Katz,S.G. and Rosenbaum,J.L.(1994).A new kinesin-like protein (Klp1) localized to a single microtubule of the Chlamydomonas flagellum. J. Cell Biol. 125 (6), 1313-1326

QA6. PCR techniques and Shotgun sequencing

QA7. Done (file name C.reinhardtii.txt)

Part B. PCR Primer Design

1 AAAGGATCTGTCTGCGGGTCCAGTGAACAATCAGCAGGAGCAGTTCTCCTTCAAGTTTGA

61 CGGCGTGTTGGAGAATGTGAGCCAGGAGGCAGCGTACACGACTCTGGCGCATGAGGTGGT

121 GGACAGCCTCATGGCCGGATACCACGGAACTATCTTCGCGTACGGCCAGACGGGTGCTGG

181 TAAGACGTTCACGATGTCCGGCGGCGGCACGGCGTATGCGCATCGCGGCCTCATCCCCCG

241 CGCTATCCACCACGTGTTCCGGGAGGTAGACATGCGAGCGGACAAGATGTACCGCGTTCA

301 TGTGTCGTACCTCGAGATTTACAACGAGCAACTGTACGACCTGCTGGGAGACACACCCGG

361 GACCAGCGACGCGCTGGCAGTGCTGGAGGATTCAAACAGCAATACATACGTCCGCGGCCT

421 GACGCTGGTGCCGGTGCGCAGCGAGGAGGAGGCGCTGGCGCAGTTCTTCCTGGGCGAGCA

481 GGGCCGCACCACTGCCGGACACGTGCTCAACGCGGAGAGCAGCCGCTCGCACACGGTGTT

>>>>>>>>>>>>>>

541 CACTATTCACGTGGAGATGCGCACCAGTGATGCCGCCAGCGAGCGTGCTGTCCTCTCCAA

601 GCTGAACCTGGTGGACCTGGCCGGCAGCGAGCGCACCAAGAAGACCGGCGTGACCGGCCA

661 GACGCTGAAGGAGGCGCAGTTCATCAACCGCTCGCTGTCCTTCCTGGAGCAGACCGTCAA

<<<<<<<<<<<<<<<<<<<<

721 TGCGCTCAGCCGCAAGGACACATACGTGCCGTTCCGCCAGACCAAGCTGACGGCGGTGCT

781 GCGGGACGCGCTGGGCGGCAACTGCAAGACGGTCATGGTGGCCAACATCTGGGCCGAGCC

841 GAGCCACAATGAGGAGACCCTGAGCACGCTGCGCTTCGCATCGCGCGTGCGCACGCTGAC

901 CACCGACCTGGCGCTGAATGAGAGCAACGACCCGGCGCTGTTACTGCGGCGGTATGAGCG

961 CCAGATCAAGGAGCTAAAGGCGGAGCTGGCTATGCGGGACACACTCAGCGGCAAGGGCCG

1021 TGTGTCGTACGACGACTTGACTGATGACGAGCTGCGCGAGCTGCACGCCACCTGCCGCCG

1081 CTTCCTGCACGGCGAGGCGGAGCCGGAGGACCTGCCGGCCGACTCCATGAAGCGTGTGCG

1141 GGAGACGTTCAAGGCACTGCGGGCGGTGCACGTCGCCATCAAGGCCGACATGGCCACCCA

1201 GATGGCCACATTGCGCCGGGCCACGGAGGAGGGCAGCGGAGCGGCTGCTCGCGGCGGTGA

1261 CTCGGCCGGCCCCAGCGGTGTGGGCGATGTGGACCTGCGCGCCACCGGAGGCTTCACGGT

1321 GGGGCACGCACCGCTGGACGCGCGGCCGCCCGTGCGCTCCGAGCTGGGCTCCCCAGGGGC

1381 CGGTGCCAGCGGTGCAGAGGCACTGGGTGAGCCGCGCTCCCCCGGCGGCGGCCTGCATGC

1441 CCAGGCCAGCTCTCACACGGACGCCGGCAGCAACTGGGGCGATGCAGGGCCGCTGAGCAG

1501 TCCCGGCGGTACTCGGCTGGCGGGCATCTTCGGTGTGTCTGGCGATCGCAATGCCGTTTT

1561 CCGACGCTACAAGGTGGATGTGGGCGAGGGCCGCGAGCTGGCGGCGTCG

Left Primer: 3’ TCGCACACGGTGTTCACTAT 5’

Right Primer: 5’GTCTGCTCCAGGAAGGACAG 3’

Tm (in ºC) = 2(A+T) + 4(C+G)

(A+T) = sum of A and T residues in the primer

(C+G) = sum of C and G residues in the primer

Therefore 3’ TCGCACACGGTGTTCACTAT 5’

= 2(6+4) + 4(6+4)

=60 Celsius

For ‘5 GTCTGCTCCAGGAAGGACAG 3’

=2(5+3) + 4(5+7)

= 64 Celsius

Annealing Temperature

Ta Opt = 0.3 x(Tm of primer) + 0.7 x(Tm of product) – 25

= 0.3(60) + 0.7(64) -25

=37.8 Celsius

C Phylogenetic Analysis

Question C1.

Close Relatives: Chlamydomonas reinhardtii

Volvox carteri f. nagariensis, Batrachochytrium dendrobatidis JAM81 and Saccoglossus kowalevskii

Type of Blast: blastp

Outcrop: NP_012844 Saccharomyces cerevisiae S288c

Type of Blast: blastp

Question 2

Done (Print out and the end of the document).

Question 3

Amino acids share many common physical-chemical properties and are more easily exchanges with each other than unrelated amino acids

Question 4

Bioinformatics

Question 5

WAG+G+I11 Model and BIC Score 13003.981

Question 6

Bioinformatics 1

Question 7

The sequences that are most closely related to US2 are: Chlamydomonas reinhardtii

Volvox carteri f. nagariensis, Batrachochytrium dendrobatidis JAM81, Saccoglossus kowalevskii and Saccharomyces cerevisiae S288c respectively

Bootstrapped shows the confidence level with the number of branches and sub-braches. The few number of related branches the lower the confidence level and vice versa

Part D. Hydrophobicity Analysis

Q D1. It gives information of how the protein is structured. Where values greater than zero

are likely exposed on the surface for the folded amino acid

Q D2. By predicting the structure of the protein it helps in the development of potential

antigenic region of polypeptides.

Q. D3. Yes the results are expected and results are similar to the function of the protein

Q. D4. Hydrophilicity analysis of the surface properties of protein its helps one understand

the interaction that occurs between proteins and other macromolecules. This will help model and predict its interaction with antibodies. Sections whose values are greater than zero are exposed therefore, would make a good antigenic site

Appendix

Bioinformatics 2